Rephonic
Artwork for Welcome to Tinsel Town: A Christmas Adventure

Welcome to Tinsel Town: A Christmas Adventure

Triangle Content

After making a wish on the Christmas Star, Holly finds herself popping in and out of Tinsel Town, a magical place where it’s Christmas everyday. But after getting stuck there, her friends - a giant candy cane, a mysterious ornament, and a polar bear Queen - need to band together to help her get home. As things start to fall apart in Tinsel Town, the curmudgeonly Conductor accuses Holly of ruining ... more

PublishesDailyEpisodes8Founded7 years ago
Categories
Comedy FictionStories for KidsFictionKids & Family

Listen to this Podcast

Artwork for Welcome to Tinsel Town: A Christmas Adventure

Latest Episodes

Part 7 of 7 – One last try...

Having been contacted by the Christmas Star, Remington is able to put the pieces together and tell everyone just what’s been going on. It appears that Holly may belong on the nice list after all, and the cause of Tinsel... more

Part 6 of 7 – Objection...

Holly is brought before the Christmas Council, a panel of seven mysterious snowmen who separate the naughty from the nice. The Conductor has finally caught Holly committing a crime that he thinks should land her on the nau... more

Part 5 of 7 – Evasive maneuvers....

Armed with their information from the library, Holly, Cornelius, and Remington know how to find the Christmas Star, but they need a pilot to take them to the highest peak in the mountains. A daredevil sleighmaker ... more

Part 4 of 7 – A Christmas clue...

Holly immediately gets to work trying to figure out how she will get home from Tinsel Town. She travels to the library with Cornelius and Remington, but gets more than she bargained for when she sneaks into a myster... more

Key Facts

Accepts Sponsors
Contact Information
Podcast Host

Similar Podcasts

People also subscribe to these shows.

Reviews

4.6 out of 5 stars from 523 ratings
  • Roller derby girl

    We need season two NOW 🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏PLEASE PLEASE PLEASE

    Season 3 season 4 many season 5🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏🙏

    Apple Podcasts
    5
    ccccccccaaaaaaatttttt
    United Kingdom5 months ago
  • Please

    MAKE MORE PLEASE 🙏

    Apple Podcasts
    5
    SantaCat2022
    United Statesa year ago
  • Best podcast ever

    This is the best Christmas podcast I have ever listened to I listen to it any time I need to get in the Christmas spirit

    Apple Podcasts
    5
    257890652
    United Statesa year ago
  • Podcast

    This podcast was a great podcast advent calendar so far my family can’t wait since 7days till Christmas to see how it ends! With only a few episodes left!!!! You should make another season!

    Apple Podcasts
    5
    Andy1729_A4
    United Statesa year ago
  • Great story

    Soooooooooooooooooooo good

    Apple Podcasts
    5
    MindleJShed
    United Statesa year ago

Chart Rankings

How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.

Audience Metrics

Listeners, social reach, demographics and more for this podcast.

Gender SkewLocationInterests
ProfessionsAge RangeHousehold Income
Social Media Reach

Frequently Asked Questions About This Podcast

Where can I find podcast stats for this podcast?

Rephonic provides a wide range of podcast stats for this podcast. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to this podcast and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.

How many listeners does this podcast get?

Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for this podcast, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.

What are the audience demographics for this podcast?

Rephonic provides comprehensive predictive audience data for this podcast, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.

How many subscribers and views does this podcast have?

To see how many followers or subscribers this podcast has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.

How many episodes of this podcast are there?

this podcast launched 7 years ago and published 8 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.

How do I contact this podcast?

Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.

Where can I see ratings and reviews for this podcast?

Rephonic pulls ratings and reviews for this podcast from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.

View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.

How do I access podcast episode transcripts for this podcast?

Rephonic provides full transcripts for episodes of this podcast. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.

Find and pitch the right podcasts

We help savvy brands, marketers and PR professionals to find the right podcasts for any topic or niche. Get the data and contacts you need to pitch podcasts at scale and turn listeners into customers.
Try it free for 7 days